2843 S. Bartells Dr.  |  Beloit, WI 53511  |  Phone: (608) 884.9877

14-DNA2700 Assembly Instructions

   Minimize

       14-DNA2000, 14-DNA2700 and 14-DNA6000
                       Assembly Instructions


Complete Assembly from Kit:

Kit Contents:

                                                         14-DNA2000                  14-DNA2700                  14-DNA6000

Height                                                          2' foot                               3' foot                          6' foot

Atoms
                                           
Carbon tetrahedral (23mm, black)            103                                  176
Carbon trigonal (23mm, black)                   95                                   162
Oxygen divalent (23mm, red)                      71                                   124
Oxygen Mol-Dome (19mm, red)                  41                                    72
Nitrogen trigonal (23mm, blue)                    50                                    85
Nitrogen divalent (23mm, blue)                    20                                   34
Phosphorus (23mm, purple)                        18                                    32
Hydrogen Mol-Dome (19mm, white)           196                                  335
Hydrogen linear (17mm, white)                    25                                   43

Bonds
V-Bond (clear)                                            195                                   332
Short bond (clear)                                      497                                   857

Full Assembled Stand                                    1                                     1


Assembly Instructions for 14-DNA2000, 14-DNA2700 and 14-DNA5000

Thymine Adenine Base Pair DNA Double Helix Molecular Model KitStep 1:  Assemble 5 (for the 10 base pair kit), 8 (for the 17 base kit) and 17 (for the 35 base pair kit) of the Thymine and Adenine Base Pairs as follows:

Note: the current layout is T-A with the 3' end on the left and the 5' end on the right .

Note:  The 5 V-bonds in the Adenine to the right.  You will use these to accommodate the strain created by the bond angles.  Also note the use to highlight the covalent H-bonding created between the A-T base pair.  Lastly, at the R' site on each base to help accomodate the strain created by the DNA back bone.  All other bonds are short bonds including those under the hydrogen Micro-Domes.









G-C Base Pair for DNA model kitStep 2: Assemble your Guanine - Cytosine Base Pairs as shown to the right.  You will need 5 (for the 10 base pair kit), 9 (for the 17 base pair kit) and 18 (for the 35 base pair kit).

Note: the current layout is G-C with the 3' end on the left and the 5' end on the right .



















DNA molecular model kit base pair assemblyStep 3:  Now take your assembled base pairs and orient them on their shelves.  The R' binding sites will be facing you as you assemble them on the fully assembled stand.  The pre-drilled holes where the base can be zip tied into place will be on the back of the shelf.  Below is the shelf orientation for all three available model lines.


10 base pair kit:


     #1-------------->10
   3' TCGATTGAGC 5'
   5' AGCTAACTCG 3'
   Base---------------->Top

17 base pair kit:

     #1----------------------------->17
   3' TCGATTGAGCTCTAGCG 5'
   5' AGCTAACTCGAGATCGC 3'
   Base------------------------------>Top

35 base pair kit:

     #1------------------------------------------------------------------->35
   3' TCGATTGAGCTCTAGCGTCGATTGAGCTCTAGCGC 5'
   5' AGCTAACTCGAGATCGCAGCTAACTCGAGATCGCG 3'
   Base-------------------------------------------------------------------->Top

DNA top stand view for molecular model double helix model kitRemember to orient your stand in front of you with the shelf zip tie holes at the back as follows:







 

 

 

 

 




DNA double helix model base orientation on shelfNow orient your molecule on the shelf.  Note the shelf supports the full molecule and allows the molecule to be secured between the 2 carbons on the Adenine and Thymine bases.  (Shelve shown removed for ease of demonstration)





















DNA double helix securing the DNA bases of the modelRole the zip ties over and secure it.  Do not apply excessive force as you will separate your model at the joint between the 2 carbons.  Firm pressure can easily be applied.






















DNA double helix completed shelfYour completed DNA base secured on its respective shelf.
























The following shows the orientation for the A - T and T - A Base Pairs.

DNA double helix adenine thymine base pair orientation3' Adenine - Thymine 5'


























DNA double helix thymine adenine base pair3'  Thymine - Adenine 5'


























DNA double helix DNA base pair errorThe following demonstrates the WRONG placement of a DNA base on a shelf.  Note how the right side of the base pair is not supported and the excessive shelf on the left.


 

 

















The following shows the orientation for the C - G and G - C Base Pairs.

DNA double helix Guanine to Thymine base pair3' Guanine - Cytosine 5'


























DNA double helix base pair cytosine to guanine3' Cytosine - Guanine 5'


























DNA double helix completly assembled base pair GCAs above your final assembled molecule affixed to its shelf should resemble this 3' G - C 5' base pair.
























DNA back bone componentStep 4:  Assemble 18 (for the 10 base kit), 32 (for the 17 base kit) and 68 (for the 35 base pair kit) of the C5 carbon phosphodiester units as follows:
 






















DNA deoxyribose sugar unit molecular modelStep 5:  Assemble the ribose sugars.  You will build 20 (for the 10 base kit), 34 (for the 17 base kit) and 68 (for the 35 base pair kit) as follows. 

The first set of 10, 17 and 34 shown will be attached to the right side of the assembled base pairs.  Keep the piles labeled and separated when complete.

In the picture to the right the left side molecule is the top completed view and the right, the underside (molecule is flipped over).  Note the orientation of the ring as this is how it will be added to the DNA structure.  C3 is open for the addition of the phosphate unit above.  The DNA base will be attached to the undersurface at C1 in the left model example.






DNA model deoxyribose modelNow assemble the second set of 10, 17  and 35 sugar rings which will be attached to the left side of the assembled base pairs.  Keep the piles labeled  and separated when complete.

Again the left molecule notes the orientation when assembled to your model.  You see the open C1 site at the right upper location adjacent to the oxygen.  The hydrogen is on the undersurface on the right molecule structure.  Also note on the left molecule that the C4 position is open also.  You will attach the C5 carbon from the phosphate chain created above.









Continued Assembly of 14-DNA2000, 14-DNA2700, 14-DNA2700PC and 14-DNA5000 Kit:

Kit contents (or completed components from above):

DNA double helix model base pair orientationStep 6:  Begin assembly of the phosphodiester-deoxyribose "Back Bone".  You will want the R' binding sites of the Base Pairs to face you when beginning the assembly process of the 5' to 3' and 3' to 5' chains. 




















DNA double helix model ribose attacmentWith the model facing you begin on your right.  Start at the base and attach the C1 site of the ribose on to the R' binding site on the lowest base pair.  Note on the right side you will have the oxygen in the ring structure facing you.  The hydrogen at the C1 site will be in the superior position.  Attach ALL the units up the right side of the model as noted.
















DNA double helix model left side ribose unitNow complete the same steps for the Left side.  Note the oxygen atom is facing away from you in the lower right corner.







 













DNA double helix model attach phosphorus unitNow attach your phosphorus and C5 unit to the ringed structures on the right (note DNA base pairs are empty in example for simplicity).  Note the attachment of the oxygen to the open C3 carbon and the open C5 carbon to the upper right.














 

 

deoxyribose sugar back bone for DNA molecular model kitNow attach the other side as follows.  This will allow you to keep the orientation straight as you work your way up the right and left side of the model.

 

 

 

 

 

 

 

 

 

 


 

DNA molecular model kit from molecular models companyNow that the bottom base pair is marked with the correct orientation for the 3'-5' left and 5'-3' right you can begin the rotation of the shelves.

 

 

 














 




DNA molecular model kitAs you begin to rotate your DNA model to the right remember to approxiamte the very bottom DNA base and the 10th base pair up from the bottom.  You will continue up the base pairs to the top giving you 1.5 complete turns.




















DNA double helix phosphate deoxyribose back boneYou will now attach the C5 carbon to the open undersurface of the C4 carbon on the ringed structure above.  Work your way up the right side 5' - 3" before finishing the left.
















DNA B DNA molecular model kit from molecular models companyYour finished model will look like this when the left side is complete.

 

 

 

 

 

 

 

 

 

 


 

Repeat the same for the other side (3' -> 5') on the Left side as shown.  Note you will be attaching the C5 carbon to the C4 open site and then the open oxygen to the above ringed structures C3 open bonding site.  See next picture.





























DNA double helix molecular model with modelEnjoy your fully assembled model (14-DNA2700 double helix represented in back ground).

 

 

 

 

 

 

 

 

 

 

 

 


 





 

Copyright 2010 by Molecular Models Company Home | About Us | Products | Compare Sizes | FAQs | Contact Us | Guarantees | Distributorship Terms Of Use  Privacy Statement
 | Login